View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_high_75 (Length: 217)
Name: NF3117_high_75
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_high_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 14527070 - 14526884
Alignment:
| Q |
19 |
gaaagatctccatagcattgtgctaggccatagttatcatcaggtcctgtccctgtaactgctgtgccgaagccggtactgcgcatctgctcgctaatct |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14527070 |
gaaagatatccatagcattgtgctaggccatagttatcatcaggtcctgtccctgtaactgctgtgccgaagccggtactgcgcatctgctcgctaatct |
14526971 |
T |
 |
| Q |
119 |
tctccatagtcgcaacaaaattcggaacaaagatgcttgtgttatgctctacttgatggccacatgttatcataactgtctctgctc |
205 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14526970 |
tctccatagttgcaacaaaattcggaacaaagatgcttgtgttatgctctacttgatggccacatgttatcataactgtctttgctc |
14526884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University