View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_low_24 (Length: 400)
Name: NF3117_low_24
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 284 - 396
Target Start/End: Original strand, 4704074 - 4704186
Alignment:
| Q |
284 |
aattggagggaaagtgaacaaaatcttttgaaactcacagatactaaccatattcacctacttatgctctaaacaaacaagttttttatataagtggaag |
383 |
Q |
| |
|
|||| ||||||||| ||||| |||||||| |||||||||||||| | | | |||||||||| |||| ||||| |||||||||| | | ||||||| || |
|
|
| T |
4704074 |
aatttgagggaaagggaacacaatcttttcaaactcacagataccatctctcttcacctactcatgcactaaataaacaagtttataacataagtgtaaa |
4704173 |
T |
 |
| Q |
384 |
agtatatattgaa |
396 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
4704174 |
agtatatgttgaa |
4704186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 206
Target Start/End: Original strand, 4703060 - 4703098
Alignment:
| Q |
168 |
tgaacatttcagcacagtatagctaacttgtctcctact |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4703060 |
tgaacatttcagcacagtatagctaacttctctcctact |
4703098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University