View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_low_36 (Length: 339)
Name: NF3117_low_36
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 327
Target Start/End: Complemental strand, 25607140 - 25606832
Alignment:
| Q |
19 |
tctttgccaccaatccttccttgattagttgacannnnnnnngtcccctgtgaatgaatcatagaaaaaccaaacctcaaattctgatctctaaaatatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25607140 |
tctttgccaccaatccttccttgattagttgacattttttttgtcccatgtgaatgaatcatagaaaaaccaaacctcaaattctgatttctaaaatatt |
25607041 |
T |
 |
| Q |
119 |
cttcagatacgaaattcgtttgttttgatttttaaggtatagagatctgttccttgcttcttaagttattattatttaaatgcatcttcttgtttaatct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25607040 |
cttcagatacgaaattcgtttgttttgatttttaaggtatagagatctgttccttgcttcttaagttattattatttaaatgcatcttcttgtttaatct |
25606941 |
T |
 |
| Q |
219 |
atcatattatcttggatttatgtgccgcacgtataattacactttttcaatccttagttaaagacaaatgttgataccacgttgtttccatcaccacaaa |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25606940 |
atcatattatcttggatttatgtgccgcacgtataataacactttttcaatccttagttaaagacaaatgttgataccacgttgtttccatcaccacaaa |
25606841 |
T |
 |
| Q |
319 |
ctattgttc |
327 |
Q |
| |
|
||||||||| |
|
|
| T |
25606840 |
ctattgttc |
25606832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University