View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_low_37 (Length: 337)
Name: NF3117_low_37
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 12 - 323
Target Start/End: Complemental strand, 27605642 - 27605331
Alignment:
| Q |
12 |
atgaaaggattaggattgtgcccaaacagtatcacattctcaatacttatagtggcaagtgagaagtaagtggtctatgtggatgtgttgtcaaattaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27605642 |
atgaaaggattaggattgtgcccaaacagtatcacattctcaatacttatagtggcaagtgagaagtaagtggtctatgtggatgtgttgtcaaattaat |
27605543 |
T |
 |
| Q |
112 |
gatttagtttgggttcttacttggacacatttattttctgcctgcttttgtaggaaggatgatatggaagctgctcaaatgctcctttctcaagccaaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27605542 |
gatttagtttgggttcttacttggacacatttattttctgcctgcttttgtaggaaggatgatatggaagctgctcaaatgctcctttctcaagccaaaa |
27605443 |
T |
 |
| Q |
212 |
aggatggtgcagcacctactctcatcatgtgtcgatgcataattggtgagcattgtagtattttgtcagatttatcgattatttttctacttgctttaaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27605442 |
aggatggtgcagcacctactctcatcatgtgtcgatgcataattggtgagcattgtaggattttgtcagatttatcgattatttttctacttgctttaaa |
27605343 |
T |
 |
| Q |
312 |
aaagtatgtggt |
323 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27605342 |
aaagtatgtggt |
27605331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University