View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_low_56 (Length: 251)
Name: NF3117_low_56
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_low_56 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 9 - 208
Target Start/End: Complemental strand, 192989 - 192787
Alignment:
| Q |
9 |
gattattctgaactgcaaagaaagctcaccgaagcaatatcatgctcaagtaattcatattctgctaaacaatattgtgtaaccaaatatattttaaatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
192989 |
gattattctgaactgcaaagaaagctcaccgaagcaatatcatgctcaagtaattcatattctgctaaacaatattgtgtgaccaaagatattttaaatt |
192890 |
T |
 |
| Q |
109 |
ctttttgtttctgaaaattcatgtttttattgaatca---tgcaggtttgcaagagaattcatttgaacctgaaattgacaatatcttgagataaatgta |
205 |
Q |
| |
|
| |||||||||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
192889 |
cgttttgtttctcaatattcatgtttttattgaatcattttgcaggtttgcaagagaattcatttgaacctgaaattgacaatatcttgagataaatgta |
192790 |
T |
 |
| Q |
206 |
tta |
208 |
Q |
| |
|
||| |
|
|
| T |
192789 |
tta |
192787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University