View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_low_60 (Length: 248)
Name: NF3117_low_60
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_low_60 |
 | |
|
| [»] scaffold0565 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0565 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 107 - 203
Target Start/End: Original strand, 5752 - 5850
Alignment:
| Q |
107 |
atgattcaacacattgtagccattatagtctagtagtac--taattaaccatcaaatatttactactatcttatactccatccgtcccatattataagc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5752 |
atgattcaacacattgtagccattatagtctaatagtacactaatcaactatcaaatatttactactatcttatactccatccgttccatattataagc |
5850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0565; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 5644 - 5689
Alignment:
| Q |
19 |
taaatgaaatgacttataaatttaaagaaaatgataatcgatattg |
64 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
5644 |
taaatgagatgatttataaatttaaagaaaatgataatcaatattg |
5689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University