View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3117_low_60 (Length: 248)

Name: NF3117_low_60
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3117_low_60
NF3117_low_60
[»] scaffold0565 (2 HSPs)
scaffold0565 (107-203)||(5752-5850)
scaffold0565 (19-64)||(5644-5689)


Alignment Details
Target: scaffold0565 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: scaffold0565
Description:

Target: scaffold0565; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 107 - 203
Target Start/End: Original strand, 5752 - 5850
Alignment:
107 atgattcaacacattgtagccattatagtctagtagtac--taattaaccatcaaatatttactactatcttatactccatccgtcccatattataagc 203  Q
    |||||||||||||||||||||||||||||||| ||||||  |||| ||| ||||||||||||||||||||||||||||||||||| |||||||||||||    
5752 atgattcaacacattgtagccattatagtctaatagtacactaatcaactatcaaatatttactactatcttatactccatccgttccatattataagc 5850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0565; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 5644 - 5689
Alignment:
19 taaatgaaatgacttataaatttaaagaaaatgataatcgatattg 64  Q
    ||||||| |||| |||||||||||||||||||||||||| ||||||    
5644 taaatgagatgatttataaatttaaagaaaatgataatcaatattg 5689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University