View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3117_low_61 (Length: 246)

Name: NF3117_low_61
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3117_low_61
NF3117_low_61
[»] chr1 (1 HSPs)
chr1 (109-231)||(3925423-3925545)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 109 - 231
Target Start/End: Complemental strand, 3925545 - 3925423
Alignment:
109 gctccatttgcatatggtccaagcttcaatttatgatttatatacaaacatgagtaaacgatcatagatctgaagactatgagctcacatgaaaatagaa 208  Q
    |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
3925545 gctctatttgcatatggtccaagcttcaatttaagatttatatacaaacatgagtaaacgatcatagatctgaagactatgagctcatatgaaaatagaa 3925446  T
209 ttatatatttaaaatttgaaaat 231  Q
    ||||| |||||||||||||||||    
3925445 ttatagatttaaaatttgaaaat 3925423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University