View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_low_64 (Length: 242)
Name: NF3117_low_64
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 20493785 - 20494009
Alignment:
| Q |
1 |
atagattaaggaggcgactccagtttgagacaacccttaggatacgagacacatatgggtttaagggtagtgttgtgaaaccaacgatctcgatatttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20493785 |
atagattaaggaggcgactccagtttgagacaacccttaggatacgagacacatatgggtttgagggtagtgttgtgaaaccaacgatctcaatatttta |
20493884 |
T |
|
| Q |
101 |
acacactatttatctactataaattatgtgattttcaagatgattttaaaaaaggggaatgggtatctcagttgatttgagtgaa-ggatttatggagtt |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
20493885 |
acacactatttatctattataaattatgtgattttcaagatgattttaaaaaatggggttggatatctcagttgatttgagtgaagggatttaaggagtt |
20493984 |
T |
|
| Q |
200 |
gatgaattaaaagtctacaagttct |
224 |
Q |
| |
|
|||||||||| ||||||||||||| |
|
|
| T |
20493985 |
aatgaattaaacgtctacaagttct |
20494009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University