View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3117_low_66 (Length: 240)

Name: NF3117_low_66
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3117_low_66
NF3117_low_66
[»] chr1 (1 HSPs)
chr1 (1-222)||(42609967-42610188)
[»] chr5 (1 HSPs)
chr5 (161-222)||(43216524-43216585)


Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 42610188 - 42609967
Alignment:
1 ttatggaacatattttagatggaagttattatggtaaggctgcacaaaaagtacatgagattaatccacttcagaagcccaaacaagatagatacgcgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42610188 ttatggaacatattttagatggaagttattatggtaaggctgcacaaaaagtacatgagattaatccacttcagaagcccaaacaagatagatacgcgat 42610089  T
101 tcgaacatcaccgcagtggcttggaccgcagattgaagtgattcgatacgcaacaaagatgattgagagggagataaattccgtgaatgacaatccactt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42610088 tcgaacatcaccgcagtggcttggaccgcagattgaagtgattcgatacgcaacaaagatgattgagagggagataaattccgtgaatgacaatccactt 42609989  T
201 attgatgtttcaagggataagg 222  Q
    ||||||||||||||||||||||    
42609988 attgatgtttcaagggataagg 42609967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 222
Target Start/End: Original strand, 43216524 - 43216585
Alignment:
161 gattgagagggagataaattccgtgaatgacaatccacttattgatgtttcaagggataagg 222  Q
    |||||| |||||||||||||| ||||| |||||||| || ||||||||  ||| ||||||||    
43216524 gattgaaagggagataaattcagtgaacgacaatcctctgattgatgtggcaacggataagg 43216585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University