View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_low_73 (Length: 232)
Name: NF3117_low_73
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_low_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 218
Target Start/End: Original strand, 40211393 - 40211592
Alignment:
| Q |
19 |
cttcgatcttaagttaataccaccacgccaccttaaacgagttttcgtgttgttaatcataaaaactaattttacttctatattcaaattaaatttgttt |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40211393 |
cttcgatcttaagttaatatcaccacgccaacttaaacgagttttcgtgttgttaatcataaaaactaattttacttctatactcaaattaaatttgttt |
40211492 |
T |
 |
| Q |
119 |
gatctctgggaagatgtctgtttgatcaagcatcttaaaatggaatgtaatagctcttgtactcttttatataaatttcatttctcattaaaagaataat |
218 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
40211493 |
gatctctgggaagatgtctctttgatcaagcatcttaaaatggaatggaatagatcttgtactcttttatataaatttcatttcacattaatagaataat |
40211592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University