View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_low_76 (Length: 226)
Name: NF3117_low_76
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_low_76 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 5 - 226
Target Start/End: Original strand, 51393262 - 51393485
Alignment:
| Q |
5 |
catccctcaccttaaaaattggtggttgagttgatcattgaactcaaattttaagataatatcatagctatgcaagttcagttgggtaagctgcaaacct |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51393262 |
catccctcaccttaaaaattggtggttgagttgatcattgaactcaaattttaagataatatcattgctatgcaagttcagttgggtaagctgcaaacct |
51393361 |
T |
|
| Q |
105 |
gaaaccgttaaaaccagctaaatttttatttttaaccaaaaacacgct-aattttatacgcagcatggtatgaatatgatggtgctcgaaactt-aaaat |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| | |||||| ||||| |
|
|
| T |
51393362 |
gaaaccgttaaaaccagctaaatttatatttttaaccaaaaaccagctaaattttatacgcagcatggtatgaatatgatggtgcccaaaacttaaaaat |
51393461 |
T |
|
| Q |
203 |
aaaattaatgaacaagcaaacacc |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
51393462 |
aaaattaatgaacaagcaaacacc |
51393485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University