View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_low_83 (Length: 202)
Name: NF3117_low_83
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_low_83 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 19 - 180
Target Start/End: Original strand, 4072714 - 4072875
Alignment:
| Q |
19 |
ataccaacataatccgaatattttcaa-gtgtccgagcatgagatagagtctcggatagaaataatatatcaacttttatccccgagctaggtttcgaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
4072714 |
ataccaacataatccgaatattttcaaagtgtccgagcatgagatagagtctca-atagaaataatatatcaacttttctccccgagccaggtttcgaag |
4072812 |
T |
 |
| Q |
118 |
attaggaattgcactcgggccatccaatctccagcaatttcaagtgaggataatcattggtcc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4072813 |
attaggaattgcactcgggccatccaatctccagcaatttcaagtgaggataatcattggtcc |
4072875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University