View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3118_high_11 (Length: 243)
Name: NF3118_high_11
Description: NF3118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3118_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 5 - 170
Target Start/End: Complemental strand, 26467090 - 26466924
Alignment:
| Q |
5 |
tttttacatcttttaaaggcatattatgagcaaatatggttatgtattttgaaattttaatg-attcaaagatttttcagtaagaaatgacataccatgc |
103 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26467090 |
tttttacatcttttacaggcatattatgagcaaatatggttatgtattttgaaatttgaatgtattcaaagatttttcagtaagaaatgacataccatgc |
26466991 |
T |
|
| Q |
104 |
ttcatcaagaagagcaataattccaccaggtttctgcattcagaacaaataaatagtttcagaattt |
170 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||||| ||||||||||||| |
|
|
| T |
26466990 |
ttcatcaagaagcgcaataattccaccaggtttttgcattcaggacaaataaagagtttcagaattt |
26466924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 139
Target Start/End: Original strand, 29897816 - 29897862
Alignment:
| Q |
93 |
acataccatgcttcatcaagaagagcaataattccaccaggtttctg |
139 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
29897816 |
acataccaagcttcatcgagaagagcaataatgcctccaggtttctg |
29897862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University