View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3118_high_13 (Length: 227)
Name: NF3118_high_13
Description: NF3118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3118_high_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 41990537 - 41990762
Alignment:
| Q |
1 |
ttgggaaaaaattactgtcatgtcactcatactttactaaaattacatagactttttctacatagaaatctgctattaagcaaaggagatttgcaatatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
41990537 |
ttgggaaaaaattactgtcatgtcactcatactttactaaaattacatagactttttctacatagaaatctgctattaagcaaaggaaaattgcaatatg |
41990636 |
T |
 |
| Q |
101 |
acatgaagaagaatttagtgtcaaatattacgtagcaccaactctcctgatcaaaagtgtgttcggtgtctgacatgtgccgatgtcaaatgcgacacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41990637 |
acatgaagaagaatttagtgtcaaatattatgtagcatc-actctcctgatcaaaagtgtgttcggtgtctgacatgtgctgatgtcaaatgcgacacat |
41990735 |
T |
 |
| Q |
201 |
gtgattacactcaattaattcagtttc |
227 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
41990736 |
gtgattacactcaattaattcaatttc |
41990762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 226
Target Start/End: Original strand, 49659911 - 49659943
Alignment:
| Q |
194 |
gacacatgtgattacactcaattaattcagttt |
226 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
49659911 |
gacacatgtgattacactcaattatttcagttt |
49659943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University