View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3118_low_9 (Length: 297)
Name: NF3118_low_9
Description: NF3118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3118_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 16 - 282
Target Start/End: Original strand, 33711236 - 33711502
Alignment:
| Q |
16 |
gaacctgtggttgtgtgtttctgttatgatggttattcaaggtggccatgttgaattcaaaactgcactcaactcaagaagaattcaaacactaaaaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33711236 |
gaacctgtggttgtgtgtttctgttatgatggttattcaaggtggccatgttgaattcaaaactgcactcaactcaagaagaattcaaacgctaaaaaca |
33711335 |
T |
|
| Q |
116 |
gtttcttggattgctctttcactttcttgctccctaccaaagaggcaaaaccagttggaaaaatatctcaatttccaagactctcagaagcttcaaatat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33711336 |
gtttcttggattgctctttcactttcttgctccctaccaaagaggcaaaaccagttggaaaaatatctcaatttccaagactctcagaagcttcaaatat |
33711435 |
T |
|
| Q |
216 |
gtatgattgaataaatgtcacatttcacatcacactttctttgctttacaagccattgaccaaaact |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33711436 |
gtatgattgaataaatgtcacatttcacatcacactttctttgctttacaagccattgaccaaaact |
33711502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University