View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119A-Insertion-10 (Length: 291)
Name: NF3119A-Insertion-10
Description: NF3119A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119A-Insertion-10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 8 - 290
Target Start/End: Complemental strand, 48324163 - 48323881
Alignment:
| Q |
8 |
gtgaattcaaatgctgatatacatttctcatattcaggaagtagatggagtgaatttgacacttgatcagactcttggtaattctaacccgcattattca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48324163 |
gtgaattcaaatgctgatatacatttctcatattcaggaagtagatggagtgaatttgacacttgatcagactcttggtaattctaacccgcattattca |
48324064 |
T |
 |
| Q |
108 |
agagtattgagggagaaaatggcagctagagatgcagcacacaaggcaatggaggctcgaagagctgctttggtggaggcatcttggtgccgaattttac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48324063 |
agagtattgagggagaaaatggcagctagagaagcagcacacaaggcaatggaggctcgaagagctgctttggtggaggcatcttggtgccgaattttac |
48323964 |
T |
 |
| Q |
208 |
gtgccgcgaggtaaagctttatgcaaataaaataggctggacattagttgacggtttaattaaagaaaatgatttacaaatct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48323963 |
gtgccgcgaggtaaagctttatgcaaataaaataggctggacattagttgacggtttaattaaagaaaatgatttacaaatct |
48323881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University