View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3119A-Insertion-11 (Length: 153)

Name: NF3119A-Insertion-11
Description: NF3119A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3119A-Insertion-11
NF3119A-Insertion-11
[»] chr2 (2 HSPs)
chr2 (8-97)||(41727239-41727328)
chr2 (112-153)||(41726029-41726070)
[»] chr1 (1 HSPs)
chr1 (8-75)||(31682157-31682224)


Alignment Details
Target: chr2 (Bit Score: 90; Significance: 8e-44; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 90; E-Value: 8e-44
Query Start/End: Original strand, 8 - 97
Target Start/End: Complemental strand, 41727328 - 41727239
Alignment:
Q  8 gtatctattatcgtatcagctcttttcttcattgctttcattggcttatccgttatcactattggggtatattcgtcattttcttctcac 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41727328 gtatctattatcgtatcagctcttttcttcattgctttcattggcttatccgttatcactattggggtatattcgtcattttcttctcac 41727239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 112 - 153
Target Start/End: Complemental strand, 41726070 - 41726029
Alignment:
Q  112 attcttttattaatatagaggcactcccttcgatcttgctta 153  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  41726070 attcttttattaatatagaggcactcccttcgatcttgctta 41726029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 64; Significance: 3e-28; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 31682224 - 31682157
Alignment:
Q  8 gtatctattatcgtatcagctcttttcttcattgctttcattggcttatccgttatcactattggggt 75  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31682224 gtatctattatcgtatcggctcttttcttcattgctttcattggcttatccgttatcactattggggt 31682157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University