View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119A-Insertion-19 (Length: 153)
Name: NF3119A-Insertion-19
Description: NF3119A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119A-Insertion-19 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 8 - 153
Target Start/End: Complemental strand, 53426573 - 53426428
Alignment:
| Q |
8 |
aaatgccaattgaaggtggcagtgttggcgtggcggttatttcaaaatatgattatgactaaggataacttattcagagagaagtactaaatgatgcata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53426573 |
aaatgccaattgaaggtggcagtgttggcgtggcggttatttcaaaatatgattatgactaaggataatttattcagagagaagtactaaatgatgcata |
53426474 |
T |
|
| Q |
108 |
aacagaatgctcttatgggtgtggtctgagagaaagtgcttcaata |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53426473 |
aacagaatgctcttatgggtgtggtctgagagaaagtgcttcaata |
53426428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University