View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119A-Insertion-20 (Length: 229)
Name: NF3119A-Insertion-20
Description: NF3119A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119A-Insertion-20 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 8 - 229
Target Start/End: Original strand, 19766059 - 19766280
Alignment:
| Q |
8 |
attacaaattgtaggaattaatctgaattacaaattgcccaaaggcctcaattttttattatagatatgatggtaacgaaagcaaattactctgaattgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19766059 |
attacaaattgtaggaattaatctgaattacaaattgcccaaaggcctcaattttttattattgatatgatggtaacgaaagcaaattactctgaattgt |
19766158 |
T |
|
| Q |
108 |
attagtttgtttgattgatggcacataatttctgagcaatgatttgttaataatcttctagatgtctagataaggtcgcgaatagtaagaccacctcatg |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19766159 |
attagtttgtttgattgatgacacataatttctgagcaatgatttgttaataatcttctagatgtctagataaggtcgcgaatagtaagaccacctcatg |
19766258 |
T |
|
| Q |
208 |
catatgttggctttctgtcatc |
229 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19766259 |
catatgttggctttctgtcatc |
19766280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 90 - 167
Target Start/End: Complemental strand, 3481582 - 3481507
Alignment:
| Q |
90 |
caaattactctgaattgtattagtttgtttgattgatggcacataatttctgagcaatgatttgttaataatcttcta |
167 |
Q |
| |
|
||||||||||||||| || || |||||||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3481582 |
caaattactctgaatattactaatttgtttgatggattacacag--tttctgagcaatgatttgttaataatcttcta |
3481507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University