View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119A-Insertion-8 (Length: 301)
Name: NF3119A-Insertion-8
Description: NF3119A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119A-Insertion-8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 283
Target Start/End: Complemental strand, 39850933 - 39850658
Alignment:
| Q |
8 |
gttacttatgaagctttaatagatgagaatggcttagttattcaagtcaacaaagccaaatatatattttatgcatcagttcggtgaagagtgactctta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||| ||||||||||| ||| |
|
|
| T |
39850933 |
gttacttatgaagctttaatagatgagaatggcttagttattcaagtcaacaaagctaaagatatattttatgcatcggttcggcgaagagtgactttta |
39850834 |
T |
|
| Q |
108 |
atattcctcatgattatcttctgagccattgtaaatattgtctttttcacaaaaagtggcaaacattgctagtcatgattatcttttagtctattccatt |
207 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39850833 |
atattcgtcatgattatcttctgagccatcgtaaatattatctttttcacgaaaagtggcaaacattgctagtcatgattatcttttagtctattccatt |
39850734 |
T |
|
| Q |
208 |
ttgtaaattacaattattcttgttctagatataaaatataagatcaaagggtagagttgaaactttaaaattgtgt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39850733 |
ttgtaaattacaattattcttgttctagatataaaatataagatcaaagggtagagttaaaactttaaaattgtgt |
39850658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University