View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119R-Insertion-15 (Length: 380)
Name: NF3119R-Insertion-15
Description: NF3119R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119R-Insertion-15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 9 - 380
Target Start/End: Original strand, 39625621 - 39625994
Alignment:
| Q |
9 |
actagaaggaaagaaattgactgcttattgtggcaaatataaaatcttggctttgggcttggttacgaaattgaggtgtaaattggaatttgcaagcgtt |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39625621 |
actagatggaaagaaattgactgcttattgtggcaaatataaaatcttggctttgggcttggttacgaaattgaggtgtaaattggaatttgcaagcgtt |
39625720 |
T |
|
| Q |
109 |
gtttttcttgacagtattatgatgcctactaat--gctcatgttaaaggtagaatgttgcaactagtgaatggtgacacaagtattgaattcacatgtaa |
206 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39625721 |
attcttcttgacagtattatgatgcctactaatatgctcatgttaaaggtagaatgttgcaactagtgaatggtgacacaagtattgaattcacatgtaa |
39625820 |
T |
|
| Q |
207 |
gtttggagccttatttatatgctgagttagtttttgattctgaaacaacaaaaggagttgtcaatccattggccaaaattttctggaagttcataatgca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39625821 |
gtttggagccttatttatatgctgagttagtttttgattctgaaacaacaaaaggacttgtcaatccattggccaaaattgtctggaagttcataatgca |
39625920 |
T |
|
| Q |
307 |
aaggtgggtttattttttaaaaatgtcgatcatttcacagaaacttgttctgtccaaattcatccccctcaaga |
380 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39625921 |
aaggtgggtttattttttgaaaatgttgatcatttcacagaaacttgttctgtccaaattcatccccctcaaga |
39625994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University