View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119R-Insertion-18 (Length: 285)
Name: NF3119R-Insertion-18
Description: NF3119R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119R-Insertion-18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 8060548 - 8060790
Alignment:
| Q |
9 |
acttagactttttgtttgagtttgaggaaaagggacaattttaagcaggaagaaggacaagggacgataatcttttatccatttggaggatttttgagag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8060548 |
acttagactttttgtttgagtttgaggaaaagggacaattttaagcaggaagaaggaaaagggacgataatcttttatccatttggaggatttttgagag |
8060647 |
T |
|
| Q |
109 |
aaaacttaagaccaatatttgcaagatgnnnnnnnttgaagaatatttcaaaatcttctaaaacaatccaaactctcaattcatattttgagtttttcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8060648 |
aaaacttaagaccaatatttgcaagatgaaaagaattgaagaatatttgaaaatcttctaaaacaatccaaactctcaattcatattttgagtttttcaa |
8060747 |
T |
|
| Q |
209 |
attgtgagttttagataagaaaaagtgcggaggaagatctacac |
252 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8060748 |
attgtgagttttagataag-aaaagtgcggaggaagatctacac |
8060790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University