View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119R-Insertion-19 (Length: 230)
Name: NF3119R-Insertion-19
Description: NF3119R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119R-Insertion-19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 230
Target Start/End: Original strand, 35899591 - 35899812
Alignment:
| Q |
9 |
cttcatacttagtttcttcagcttttcttgtagtccagccatgttaacttcaaacgagaaaacaacgaaatcagtaaataaatcgtcaaatcaaatataa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899591 |
cttcatacttagtttcttcagcttttcttgtagtccagccatgttaacttcaaacgagaaaacaacgaaatcagtaaataaatcgtcaaatcaaatataa |
35899690 |
T |
 |
| Q |
109 |
gcacaagtaaatcttaaagattacctaacaaacccctcgggtctgaagacttaacaaggtccttggtgttgataaaacgatcctcgttaaatgggtttcc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899691 |
gcacaagtaaatcttaaagattacctaacaaacccctcgggtctgaagacttaacaaggtccttggtgttgataaaacgatcctcgttaaatgggtttcc |
35899790 |
T |
 |
| Q |
209 |
ctcaagtcgtatagaacgtttc |
230 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35899791 |
ctcaagtcgtatagaacgtttc |
35899812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University