View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119R-Insertion-22 (Length: 187)
Name: NF3119R-Insertion-22
Description: NF3119R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119R-Insertion-22 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 9 - 187
Target Start/End: Original strand, 52824433 - 52824611
Alignment:
| Q |
9 |
gataacagatcaaacaccgtcaatttcagcagcagtttgggggatttcacagttccacagataacaatccctcccaattaacattgtcacaccttatnnn |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52824433 |
gataacagatcaaacaccgtcaatttcagcagcagtttgggggatttcacagttccacagataacaatccctcccaattaacattgtcacatcttattat |
52824532 |
T |
 |
| Q |
109 |
nnnnnnnnnncaacaatgatatagacatatctttagatttcatacattcattcaacatctgattttctctctagcactc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824533 |
atatatatatcaacaatgatatagacatatctttagatttcatacattcattcaacatctgattttctctctagcactc |
52824611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University