View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_high_14 (Length: 320)
Name: NF3119_high_14
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 4933649 - 4933357
Alignment:
| Q |
18 |
gttccaaatagcaatgcactactactagtgactgatagatgaagattctctatctcttggattatgttcatcaatgcacccttatgtttctcacaatgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4933649 |
gttccaaatagcaatgcactactactagtgactgatagatgaagattctctatctcttggattatgttcatcaatgcacccttatgtttctcacaatgga |
4933550 |
T |
|
| Q |
118 |
cacgaatcagcacgtttttctctgacactcttgcctcaacttcaggcagtgacctacttggttttgaggtttgagtgtgacaacaattaccatagccaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4933549 |
cacgaatcagcacgtttttctctgacactcttgcctcaacttcaggcagtgacctacttggttttgaggtgtgagtgtgacaacaattaccatagccaga |
4933450 |
T |
|
| Q |
218 |
atttgatgaggtgtctgaaacatcttcatctgaagaatatgactttgtcttctcaacatataccatagacacagattctacgttattcctttg |
310 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4933449 |
atttgatgaggtttctgaaacatcttcatctgaagaatatgactttgtcttctcaacatataccatagacacagattctacgttattcttttg |
4933357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University