View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_high_15 (Length: 311)
Name: NF3119_high_15
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_high_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 21 - 311
Target Start/End: Complemental strand, 11573993 - 11573703
Alignment:
| Q |
21 |
agttcggcaatataacagcctacatgcaaccatgacagcagccaacaacacagacgcaactgctacaacagaaaaccgatgcgccaacagtggccaaaca |
120 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||| | |||||| |
|
|
| T |
11573993 |
agttcggcaatatgacagcctacatgcgaccatgacagcagccaacaacacagacgcagctgcttcaacagaaaaccgatgcaccaacagcagtcaaaca |
11573894 |
T |
 |
| Q |
121 |
aattcgccagcagcagctaccctcctatgaaatcacggctagctaataaaacagttccttggattccaacacaattcataatataaacaagagggaatct |
220 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11573893 |
aattcgacagcagcagctcccctcctatgaaatcacgtctagctaataaaacagttccttggattccaacacaattcataatataaacaagagggaatct |
11573794 |
T |
 |
| Q |
221 |
tcaatcttatgcttcttcaaccccatttctaggataaatcacgggtacctaaattcaaatttacactaaggttcaataatagtccatgtga |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11573793 |
tcaatcttatgcttcttcaaccccatttctaggacaaatcacgggtacctaaattcaaatttacactaaggttcaataatagaccatgtga |
11573703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University