View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_high_19 (Length: 255)
Name: NF3119_high_19
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_high_19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 1883264 - 1883506
Alignment:
| Q |
13 |
gagacaaatcagaaaaactaaaatctagaagtttataattattatatttaatcacnnnnnnnnnnnnnnnn--tagaattgctaagaaatgattaaataa |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1883264 |
gagacaaatcagaaa--ctaaaatctagaagtttataattattatatttaatcacaaaaaaaaaaaaaaaaaatagaattgctaagaaatgattaaataa |
1883361 |
T |
 |
| Q |
111 |
taccaagatattgcaattgatacatcttcgattttcttgaagttttaaaagacctcgaattattctttcaactctttcttcttctttctttgaatttccc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1883362 |
taccaagatattgcaattgatacatcttcgattttcttgaagttttaaaagacctcgaattattctttcaactctttcttcttctttctttgaatttccc |
1883461 |
T |
 |
| Q |
211 |
atcttcaaatgctcaaatttattcctctttcaacatgcaaccttc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1883462 |
atcttcaaatgctcaaatttattcctctatcaacatgcaaccttc |
1883506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University