View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_high_23 (Length: 238)
Name: NF3119_high_23
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 21971005 - 21971219
Alignment:
| Q |
13 |
gagattcgaggtgggttcggtcttacatagctgatagagttgcaaatagctttgtcatgtttcttggacaacaaggtaaaggtgttttgtaacctgccgg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21971005 |
gagattcgaggtgggttcggtcttacatagctgatagagttgcaaatagctttgtcatgtttcttggacaacaaggtaaaggtgttttgtaacctgccgg |
21971104 |
T |
 |
| Q |
113 |
agatatctccggtgccggcagaacaaaggcacaaattgctgattttgttacccattggatagtgc---aatgcaatcaaagttgctttgaactttatgtg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
21971105 |
agatatctccggtgccggcagaacaaaggcacaaattgctgattttgttacccattggatagtgcaataatgcaatcaaagttgttttgaactttatgtg |
21971204 |
T |
 |
| Q |
210 |
tagtaatgttgctat |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21971205 |
tagtaatgttgctat |
21971219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University