View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_high_24 (Length: 237)
Name: NF3119_high_24
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 101 - 183
Target Start/End: Complemental strand, 6739657 - 6739575
Alignment:
| Q |
101 |
agccaatccaattatgatgcaatctaaccaggacacgttaatatcattttacaagcacaaacaattagatacacatgttgttc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739657 |
agccaatccaattatgatgcaatctaaccaggacacgttaatatcattttacaagcacaaacaattagatacacatgttgttc |
6739575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 6741982 - 6741916
Alignment:
| Q |
1 |
aatttatgaagtcccattctaccattagaactcgtgaccacaagccactaggatacaatatagcacc |
67 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6741982 |
aatttataaagtcccattctaccattagaactcgtgaccacaagccactaggatacaatatagcacc |
6741916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 62 - 101
Target Start/End: Complemental strand, 6739819 - 6739780
Alignment:
| Q |
62 |
agcacccctatcttttatgagcaaaaattcactctttaaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739819 |
agcacccctatcttttatgagcaaaaattcactctttaaa |
6739780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University