View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_high_27 (Length: 236)
Name: NF3119_high_27
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 2 - 227
Target Start/End: Original strand, 35843907 - 35844129
Alignment:
| Q |
2 |
atctctgttttccggcgacctttctccggcagcgttgttctgtcccttgcaactggagctcgactcgtttttcttgcagattgactccgacccacgacgg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35843907 |
atctctgttttccggcgacctttctccggcagcgttgttctgtcccttgcaactggagctcgactcgtttttcttgcagattgactccgacccacgactg |
35844006 |
T |
 |
| Q |
102 |
gtctagcaacgctggtgtcggtacacgtcgccggtgaccgggaccgtcggaaagaattctcgccggaatctctccggcgacgcattccctcgttgaccac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35844007 |
gtctagcaacgctggtgtcggtacacgtcgccggtgaccgggaccgtcggaaagaattctcgccggaatctctccggcgacgcattccctcgttg---ac |
35844103 |
T |
 |
| Q |
202 |
cattttctgacccacttggtctctgc |
227 |
Q |
| |
|
||||||| |||||| ||||||||||| |
|
|
| T |
35844104 |
cattttccgacccaattggtctctgc |
35844129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University