View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_high_28 (Length: 236)
Name: NF3119_high_28
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 29719122 - 29719006
Alignment:
| Q |
1 |
ttattggcatcaccagtgctctctctatggggtggccttgtaccgaaaacgtcttgcatgccggggaacttatttcctttggtgttcttgtttgaatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29719122 |
ttattggcatcaccagtgctctctctatggggtggccttgtaccgaaaacgtcttgcatgccggggaacttatttcctttggtgttcttgtttgaaccag |
29719023 |
T |
 |
| Q |
101 |
acattgctaaaacaaaa |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29719022 |
acattgctaaaacaaaa |
29719006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 29690418 - 29690302
Alignment:
| Q |
1 |
ttattggcatcaccagtgctctctctatggggtggccttgtaccgaaaacgtcttgcatgccggggaacttatttcctttggtgttcttgtttgaatcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29690418 |
ttattggcatcaccagtgctctctctacggggtggcctattaccgaaaacgtcttgcatgccggggaacttatttcctttggtgttcttgtttgaaccag |
29690319 |
T |
 |
| Q |
101 |
acattgctaaaacaaaa |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29690318 |
acattgctaaaacaaaa |
29690302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 129 - 221
Target Start/End: Complemental strand, 29690260 - 29690168
Alignment:
| Q |
129 |
aagggaagaaaagaagaagtttagagggttaatgaaatagtgaggaaatgtgcaatgagagcaatggagaggcgctttatttatagaaccaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29690260 |
aagggaagaaaagaagaagtttagagggttaatgaaatagtgaggaaatgtgcaatgagagcaatggagaggggctttatttatagaaccaaa |
29690168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 129 - 221
Target Start/End: Complemental strand, 29718964 - 29718872
Alignment:
| Q |
129 |
aagggaagaaaagaagaagtttagagggttaatgaaatagtgaggaaatgtgcaatgagagcaatggagaggcgctttatttatagaaccaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29718964 |
aagggaagaaaagaagaagtttagagggttaatgaaatagtgaggaaatgtgcaatgagagcaatggagaggggctttatttatagaaccaaa |
29718872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 115
Target Start/End: Original strand, 29667767 - 29667799
Alignment:
| Q |
83 |
tgttcttgtttgaatcagacattgctaaaacaa |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
29667767 |
tgttgttgtttgaatcagacattgctaaaacaa |
29667799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University