View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_high_8 (Length: 417)
Name: NF3119_high_8
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 19 - 412
Target Start/End: Original strand, 29399056 - 29399449
Alignment:
| Q |
19 |
aaatagacttaaacctcatccctttagatccatcgattaacgttaacaccgtcgatccattttggcttcagttcgaaaccattcgtcaatcacttcatcg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29399056 |
aaatagacttaaacctcatccctttagatccatcgattaacgttaacaccgtcgatccattttggcttcagttcgaaaccattcgtcaatcacttcatcg |
29399155 |
T |
 |
| Q |
119 |
ccttttaccttcaattctaacaaaactatcatcttcaccatcatcgtcatcacctctctcagctttgatctatgatgttagtttgatttcacctttggtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29399156 |
ccttttaccttcaattctaacaaaactatcatcttcaccatcatcgtcatcacctctctcagctttgatctatgatgttagtttgatttcacctttggtt |
29399255 |
T |
 |
| Q |
219 |
tccatcatggagagtttcacttttcctagctacatatatttcatagcaccagcaagaatgttttctttctttgcatatttatctgttctttctgagaaaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29399256 |
tccatcatggagagtttcacttttcctagctacatatatttcatagcaccagcaagaatgttttctttctttgcatatttatctgttctttctgagaaaa |
29399355 |
T |
 |
| Q |
319 |
gcaatgatggtaaacatttttcatgcattggtgatgctgttgaaatccctggaattgcaccaataccaaaatcttcattacctcctttgcttct |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29399356 |
gcaatgatggtaaacatttttcatgcattggtgatgctgttgaaatccctggaattgcaccaataccaaaatcttcattacctcctttgattct |
29399449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University