View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_low_17 (Length: 290)
Name: NF3119_low_17
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 19 - 280
Target Start/End: Original strand, 33683644 - 33683905
Alignment:
| Q |
19 |
gtgattagattgatatgtcaacaaccaatattatagactttaggaaatagattcaatttaacttaattgttgattttggttacttgttatgagtggccat |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33683644 |
gtgattagattgatatgtcaccaaccaatattatagactttaggaaatagattcaatttaacttaattgttgattttggttacttgttatgagtggccat |
33683743 |
T |
 |
| Q |
119 |
gctttacaattacggcagtggtaaggcctagttaagacgtatgtatgagctttaaatgcaaactcaacggtcccttctataaactctttaattaatttaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33683744 |
gctttacaattacggcagtggtaaggcctagttaagacgtatgtatgagctttaaatgcaaactcaacggtcccttctataaactctttaattaatttaa |
33683843 |
T |
 |
| Q |
219 |
tgtgctacatcatagttgccgactttgcatttgatttgccaagtgttatttccttccttctt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33683844 |
tgtgctacatcatagttgccgactttgcatttgatttgccaagtgttatttccttccttctt |
33683905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University