View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_low_31 (Length: 223)
Name: NF3119_low_31
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_low_31 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 1883785 - 1883563
Alignment:
| Q |
1 |
atcattaacatcatattattgacattatccattagattaaagaaggttagttttctaatgatttttcaattttgtttaatttactataggtaacaaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1883785 |
atcattaacatcatattattgacattatccattagattaaagaaggttagttttctaatgatttttcaattttgtttaatttactataggtaacaaaaac |
1883686 |
T |
 |
| Q |
101 |
attgaacaattttttgtttcttgagatggtttacaaacattatagcaatagtcctttc-nnnnnnnnnnnnnnnnttatagtaatattaacaaaatatat |
199 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1883685 |
attgaac-actttttgtttcttgagatggtttacaaacattatagtaatagtcctttcaaaaaaaaaaaaaaacattatagtaatattaacaaaatatat |
1883587 |
T |
 |
| Q |
200 |
gatgtaagctaaatggagttacat |
223 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
1883586 |
gatgtaagctaaatggtgttacat |
1883563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University