View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3119_low_9 (Length: 399)
Name: NF3119_low_9
Description: NF3119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3119_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 19 - 389
Target Start/End: Original strand, 34696629 - 34696981
Alignment:
| Q |
19 |
agaaccaccacagtcacaagctagagaagtttcagttggttctttcctccctccttcatcatcagacccttcttttgttctcttcaaagcttctcctaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34696629 |
agaaccaccacagtcacaagctagagaagtttcagttggttctttcctccctccttcatcatcagacccttcttttgttctcttcaaagcttctcctaaa |
34696728 |
T |
|
| Q |
119 |
gatactcctgcccttcgtgctggtaaattgattgatctttcaattttcaacacttttgttcttttgttctttacaattgatagtctagatttagttcttt |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34696729 |
gatactcctgcccttcgtgctggtacattgattgatctttcaatttt------------------gttctttacaattgatagtctagatttagttcttt |
34696810 |
T |
|
| Q |
219 |
gcaggaaatgtgcagccataccagttcatccttcccccaacatggaaacagcttcggatagctaacatactatcaggaaactactgtcaaccaaaatgtg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34696811 |
gcaggaaatgtgcagccataccagttcatccttcccccaacatggaaacagcttcggatagcaaacatactatcaggaaactactgtcaaccaaaatgtg |
34696910 |
T |
|
| Q |
319 |
cagagccatgggtggaggttaaatttgaagatgaaaaacaaggaaaaattcaggttgtggcttcacctttg |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34696911 |
cagagccatgggtggaggttaaatttgaagatgaaaaacaaggaaaaattcaggttgtggcttcacctttg |
34696981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University