View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3120-Insertion-10 (Length: 165)
Name: NF3120-Insertion-10
Description: NF3120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3120-Insertion-10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 8 - 165
Target Start/End: Original strand, 6335752 - 6335921
Alignment:
| Q |
8 |
gatataaattagggtattgctatttaagcttctgaaattgctcttacgtatccaaaat------------ctcctacaacatttaactgctggttggggt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
6335752 |
gatataaattagggtattgctatttaagcttctgaaattgctcttacgtatccaaaattaccttcaaaatctccaacaacatttaactgctggttggggt |
6335851 |
T |
|
| Q |
96 |
attaaggtaattttttggtgcgtgagatcaattttctataaattatgaacggtgtgttatacttcttgga |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6335852 |
attaaggtaattttttggtgcgtgagatcaattttctataaattatgaacggtgtgttatacttcttgga |
6335921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University