View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3120-R-Insertion-8 (Length: 162)
Name: NF3120-R-Insertion-8
Description: NF3120-R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3120-R-Insertion-8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 57 - 161
Target Start/End: Original strand, 28654294 - 28654398
Alignment:
| Q |
57 |
tcgaaacttaatttgattgttcaaattggcaactctaattacgtgaatgcaagaaatctatatccattgtggacttaagatctattctaaccatttctaa |
156 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28654294 |
tcgaaacttaatttgatagttcaaattggcaactctaattacgtgaatgcaagaaatctatatccattgtggacttaagatctattctaaccatttctaa |
28654393 |
T |
 |
| Q |
157 |
ttatt |
161 |
Q |
| |
|
||||| |
|
|
| T |
28654394 |
ttatt |
28654398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University