View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3120_high_15 (Length: 239)
Name: NF3120_high_15
Description: NF3120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3120_high_15 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 47035565 - 47035785
Alignment:
| Q |
19 |
ctcgtatccactctgccagcactgtccgtgttcaatttgacccaaccctgttctggaggagaccattgaacctgcacgggaattttgacagcatcaatgt |
118 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47035565 |
ctcgcatcaactctgctagcactgtccgtgttcaatttgacccaaccctgttctggaggagaccattgaacctgcacgggaattttgacagcatcaatgt |
47035664 |
T |
|
| Q |
119 |
tttcaaattcctttatttgagatgagttgacatactaccgagaaaaacacattatttcacccgaggagcatgaaggcgagtgaaaccttcaacacgaacc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47035665 |
tttcaaattcctttatttgagatgagttgacatactaccgagaaaaacacattatttcacccgaggagcatgaaggcgagtgaaaccttcaacacaaacc |
47035764 |
T |
|
| Q |
219 |
tccttattcttccattgccac |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47035765 |
tccttattcttccattgccac |
47035785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 235
Target Start/End: Complemental strand, 36571801 - 36571752
Alignment:
| Q |
186 |
gcatgaaggcgagtgaaaccttcaacacgaacctccttattcttccattg |
235 |
Q |
| |
|
|||||| | |||||||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
36571801 |
gcatgaggacgagtgaaaccttcaacatgaaccttcttattctttcattg |
36571752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University