View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3120_high_7 (Length: 309)
Name: NF3120_high_7
Description: NF3120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3120_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 292
Target Start/End: Complemental strand, 28014649 - 28014368
Alignment:
| Q |
11 |
ttatactaggaaattagaaggnnnnnnnggtgagtgaatccttagatgagagtgagattcttttgaatcggggtttgcaaacttttagttaaaatgcaaa |
110 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
28014649 |
ttatactaggaaattagaaggaaaaaaaggtgagtgaatccttagatgagagtgagattcttttgaatcggggtgtgcaaactttcagttaaaatgcaaa |
28014550 |
T |
|
| Q |
111 |
tgaatattggttagtatgtgtaattttgaaattaaatcctccagttgtgaaacaataagtcaacaactttacgttctttcttcatgttattttcttgcac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
28014549 |
tgaatattggttagtatgtgtaattttgaaattaaatccttcagttgtgaaacaataagtcaacagctttacggtctttcttgatgttattttcttgcac |
28014450 |
T |
|
| Q |
211 |
attcaaatgtaattttaaaaatgcgaatgcaagcaattttatacacggacatgtattggcagatgaatcaataactttagtt |
292 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28014449 |
attcaaatgtaatttaaaaaatgcgaatgcaagcaattttatacacggacatgtattggcagatgaatcaataactttagtt |
28014368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University