View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3120_low_12 (Length: 250)
Name: NF3120_low_12
Description: NF3120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3120_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 71439 - 71622
Alignment:
| Q |
18 |
gttgggaaagaggaatttgtctatgttgactcacaagcacaagactatgcttggatgatgtatcagcaaccaatgacatggctacaaacaacacaagaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
71439 |
gttgggaaagaggaatttgtctatgttgactcacaagcacaagactatgcttggatgatgtatcagcaaccaatgacatggctacaaacaacacaagaag |
71538 |
T |
 |
| Q |
118 |
aagatggttgttgtgttggtgatgatggacttgttaataatggtgttgtaactagtttcgagagttttatgtggaattactagg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
71539 |
aagatggttgttgtgttggtgatgatggacttgttaataatggtgttgtaactagtttcgagagttttatgtggaattactagg |
71622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University