View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3120_low_19 (Length: 237)
Name: NF3120_low_19
Description: NF3120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3120_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 392133 - 392334
Alignment:
| Q |
20 |
ccataattcctagcgcaaaaatgatgtctgtcatctccaaatctacttggttagctagcatctttcgaaaatcttgtacagtttttccaatgaagctacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
392133 |
ccataattcctagcgcaaaaatgatgtccgtcgtctccaaatctacttggttagctagcatctttcgaaaatcttgtacagtttttccaatgaagctacc |
392232 |
T |
 |
| Q |
120 |
tgtaaaaaatagaaagcagaaaatggaacacatcgatgatggttcttgtaaaattcctcctcgatgattggatgtttccacaccctacttcattatgatt |
219 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
392233 |
tgtaaaaaatagaaagcagaaaatgaaacacatcaatgatggttctagtaaaattcctcctcgatgattggatgtttccacaccctacttcattatgatt |
392332 |
T |
 |
| Q |
220 |
at |
221 |
Q |
| |
|
|| |
|
|
| T |
392333 |
at |
392334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University