View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3120_low_21 (Length: 231)
Name: NF3120_low_21
Description: NF3120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3120_low_21 |
 |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0219 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 10864 - 11062
Alignment:
| Q |
16 |
atgaataagggaaacaaatctttaacctcttgtgatctctcgtcgaagttgcagacagtttagaaggattttggccaatggaggttgatgatctctcttc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10864 |
atgaataagggaaacaaatctttaacctcttgtgatctctcatcgaagttgcagacagtttagaaggattttggccaatggaggttgatgatctctcttc |
10963 |
T |
 |
| Q |
116 |
atccagatttcttgtgcctctcaaagtgggaacatgatttcaacccttacacacaaaggcaatccaatgttcagaatcatggacctcccccaagaatat |
214 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10964 |
atccagatttcttatgcctctcaaagtgggaacatgatttcaacccttacacacaaaggcaatccaatgttcagaatcatggacctcccccaagaatat |
11062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 104
Target Start/End: Original strand, 15697967 - 15698022
Alignment:
| Q |
49 |
gatctctcgtcgaagttgcagacagtttagaaggattttggccaatggaggttgat |
104 |
Q |
| |
|
||||||||||||||| |||| ||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
15697967 |
gatctctcgtcgaagctgcaaacaatttggaaggattttggacaatggaggttgat |
15698022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University