View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3121_high_23 (Length: 319)
Name: NF3121_high_23
Description: NF3121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3121_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 156 - 306
Target Start/End: Complemental strand, 4261745 - 4261598
Alignment:
| Q |
156 |
cactcaggtattttcatctggtatataacaaatcttgtttaaggtttctactttaggcttggtcaacgataactagatgtgaggaggaaaagagattaaa |
255 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4261745 |
cactcaggtattttcatctggtata---caaatcttgtttaaggtttctactttaggcttggtcaacgctaactagatgtgaggaggaaaagagattaaa |
4261649 |
T |
 |
| Q |
256 |
agtcaaaagattaagcagagtacatccagcatccaacctcatatctcgttc |
306 |
Q |
| |
|
||||| |||||| ||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
4261648 |
agtcataagatttagcagagtacatccaacatctaacctcatatctcgttc |
4261598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 83
Target Start/End: Complemental strand, 4261882 - 4261818
Alignment:
| Q |
19 |
gtactaacggtatgcacgtaattgaattcacttgcaggtttaagtgaattcagctcaaatgatag |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261882 |
gtactaacggtatgcacgtaattgaattcacttgcaggtttaagtgaattcagctcaaatgatag |
4261818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University