View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3121_high_35 (Length: 236)

Name: NF3121_high_35
Description: NF3121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3121_high_35
NF3121_high_35
[»] scaffold0907 (1 HSPs)
scaffold0907 (43-223)||(630-810)


Alignment Details
Target: scaffold0907 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: scaffold0907
Description:

Target: scaffold0907; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 630 - 810
Alignment:
43 tgtctcttttcaatccatgataatcatattctttgtatattcagaacatgtcaggaagtaaacatggctccctaaaaactgaaatggattctttgcaata 142  Q
    ||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
630 tgtctcttttcaatccatgttaatcatattctttgtatactcagaacatgtcaggaagtaaacatggctccctaaaaactgaaatggattctttgcaata 729  T
143 actttgtgacgcagttacaactctcgactgttcgatctaaataaacggacatgattatttaactaagtgaagttaattgtg 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
730 actttgtgacgcagttacaactctcgactgttcgatctaaataaacggacgtgattatttaactaagtgaagttaattgtg 810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University