View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3121_high_8 (Length: 544)
Name: NF3121_high_8
Description: NF3121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3121_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 7 - 288
Target Start/End: Complemental strand, 7499321 - 7499040
Alignment:
| Q |
7 |
gcagcacagattctttaccagccaaaaactgaggatgatttttctttgcagcagtgctgaatcccataaaaacaagtgtctgattaacaaatgacatttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7499321 |
gcagcacagattctttaccagccaaaaactgaggatgatttttctttgcagcagtgctgaatcccataaaaacaagtggctgattaacaaatgacatttg |
7499222 |
T |
|
| Q |
107 |
agccattggatgaaacctaggcaccacaaaaacatctccttgctgaactctaaacctcttgtttttgcatttgtcatcattgttgcttccacataccact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499221 |
agccattggatgaaacctaggcaccacaaaaacatctccttgctgaactctaaacctcttgtttttgcatttgtcatcattgttgcttccacataccact |
7499122 |
T |
|
| Q |
207 |
cttaccattccttccccttccaacaccactgctacttctgttgccattggattccaatgtggccccaacattgatgcctttc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499121 |
cttaccattccttccccttccaacaccactgctacttctgttgccattggattccaatgtggccccaacattgatgcctttc |
7499040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 163; E-Value: 8e-87
Query Start/End: Original strand, 360 - 526
Target Start/End: Complemental strand, 7498968 - 7498802
Alignment:
| Q |
360 |
ttcataaagttataactttaactaataatgaaattatgatatggtcactgaccctggtcaaattcaccatgagaaatccaatgttgttactcttcaatcg |
459 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7498968 |
ttcataaagttataactttaactaataatgaaattatgatatggtcactgaccctggtcaaattcaccatgagaaatccaatgttgttactcttcaatcg |
7498869 |
T |
|
| Q |
460 |
ttttagttgctttttggtgactgtcgaggtccaaccataacaattttcgaagtcatggtcactatca |
526 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7498868 |
ttttagttgctttttggtgactgttgaggtccaaccataacaattttcgaagtcatggtcactatca |
7498802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University