View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3121_low_21 (Length: 335)
Name: NF3121_low_21
Description: NF3121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3121_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 6e-62; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 194 - 334
Target Start/End: Complemental strand, 19208364 - 19208224
Alignment:
| Q |
194 |
atatccaccgcttctcccttgcccttggccagtctccgtgcttctgccttagccatctcttttgcgacatcttttccatccgaatcagatagctcttcaa |
293 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
19208364 |
atatccaccgtttctcccttgcccttggccagtctccgtgcttctgccttagccatctcttttgcgacatctttcccatccgaatcagagagctcttcaa |
19208265 |
T |
 |
| Q |
294 |
cctcctctgccactgtctcaaccttgctttcaattatatcc |
334 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
19208264 |
cctcctctgccactgtctcaaccttgatttcagttatatcc |
19208224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 194 - 334
Target Start/End: Complemental strand, 19208229 - 19208089
Alignment:
| Q |
194 |
atatccaccgcttctcccttgcccttggccagtctccgtgcttctgccttagccatctcttttgcgacatcttttccatccgaatcagatagctcttcaa |
293 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||| ||||||||||| || | |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19208229 |
atatccaccgcttatcccttgcccttggccactctccctgcttctgcctcagtcgtctcttttgcgacatctttttcatccgaatcagatagctcttcaa |
19208130 |
T |
 |
| Q |
294 |
cctcctctgccactgtctcaaccttgctttcaattatatcc |
334 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
19208129 |
cctcctcagccactgtctcaaccttgctttcagttatatcc |
19208089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 194 - 331
Target Start/End: Complemental strand, 19208094 - 19207957
Alignment:
| Q |
194 |
atatccaccgcttctcccttgcccttggccagtctccgtgcttctgccttagccatctcttttgcgacatcttttccatccgaatcagatagctcttcaa |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||| || || ||||||||||| | |||||||||||||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
19208094 |
atatccaccgcttctcccttgcccttggccactcaccttgcttctgcctcaatcatctcttttgcgacatctttttcatccgaattagagagctcttcaa |
19207995 |
T |
 |
| Q |
294 |
cctcctctgccactgtctcaaccttgctttcaattata |
331 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19207994 |
cctcctctaccactgtctcaaccttgctttcaattata |
19207957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 198 - 322
Target Start/End: Complemental strand, 19207955 - 19207825
Alignment:
| Q |
198 |
ccaccgcttctcccttgcccttggccagtctccgtgcttctgccttagcca------tctcttttgcgacatcttttccatccgaatcagatagctcttc |
291 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||| | || | |||||||||||||||| ||||| ||||| | |||||||| |
|
|
| T |
19207955 |
ccaccgcttctcccttgcccttggccactctccctgcttctgcctcactcacaccttttccttttgcgacatctttctcatcctaatcatagagctcttc |
19207856 |
T |
 |
| Q |
292 |
aacctcctctgccactgtctcaaccttgctt |
322 |
Q |
| |
|
|||||||||| ||||| |||||| ||||||| |
|
|
| T |
19207855 |
aacctcctctcccactatctcaagcttgctt |
19207825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University