View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3121_low_33 (Length: 264)
Name: NF3121_low_33
Description: NF3121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3121_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 194 - 253
Target Start/End: Complemental strand, 19208364 - 19208305
Alignment:
| Q |
194 |
atatccaccgcttctcccttgcccttggccagtctccgtgcttctgccttagccatctct |
253 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19208364 |
atatccaccgtttctcccttgcccttggccagtctccgtgcttctgccttagccatctct |
19208305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 198 - 242
Target Start/End: Complemental strand, 19207955 - 19207911
Alignment:
| Q |
198 |
ccaccgcttctcccttgcccttggccagtctccgtgcttctgcct |
242 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
19207955 |
ccaccgcttctcccttgcccttggccactctccctgcttctgcct |
19207911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 194 - 242
Target Start/End: Complemental strand, 19208094 - 19208046
Alignment:
| Q |
194 |
atatccaccgcttctcccttgcccttggccagtctccgtgcttctgcct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| || || ||||||||||| |
|
|
| T |
19208094 |
atatccaccgcttctcccttgcccttggccactcaccttgcttctgcct |
19208046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 194 - 242
Target Start/End: Complemental strand, 19208229 - 19208181
Alignment:
| Q |
194 |
atatccaccgcttctcccttgcccttggccagtctccgtgcttctgcct |
242 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
19208229 |
atatccaccgcttatcccttgcccttggccactctccctgcttctgcct |
19208181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University