View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3121_low_37 (Length: 236)
Name: NF3121_low_37
Description: NF3121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3121_low_37 |
 | |
|
| [»] scaffold0907 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0907 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: scaffold0907
Description:
Target: scaffold0907; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 43 - 223
Target Start/End: Original strand, 630 - 810
Alignment:
| Q |
43 |
tgtctcttttcaatccatgataatcatattctttgtatattcagaacatgtcaggaagtaaacatggctccctaaaaactgaaatggattctttgcaata |
142 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
630 |
tgtctcttttcaatccatgttaatcatattctttgtatactcagaacatgtcaggaagtaaacatggctccctaaaaactgaaatggattctttgcaata |
729 |
T |
|
| Q |
143 |
actttgtgacgcagttacaactctcgactgttcgatctaaataaacggacatgattatttaactaagtgaagttaattgtg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
730 |
actttgtgacgcagttacaactctcgactgttcgatctaaataaacggacgtgattatttaactaagtgaagttaattgtg |
810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University