View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3121_low_41 (Length: 227)
Name: NF3121_low_41
Description: NF3121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3121_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 7 - 125
Target Start/End: Original strand, 699448 - 699566
Alignment:
| Q |
7 |
aggttttctcagatgctaactccaaaagttagagttactttggaatatttatacctattcgtcgccattactttcttctgtattctcgttgttatgcacg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699448 |
aggttttctcagatgctaactccaaaagttagagttactttggaatatttatacctattcgtcgccattactttcttctgtattctcgttgttatgcacg |
699547 |
T |
|
| Q |
107 |
ctaattacgttcaacaggt |
125 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
699548 |
ctaattacgttcaacaggt |
699566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University