View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3121_low_43 (Length: 227)
Name: NF3121_low_43
Description: NF3121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3121_low_43 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 6313257 - 6313037
Alignment:
| Q |
7 |
tggaggaccacccttgagtgaaaagatagtgcctttaccttctttaatgttnnnnnnngaagaaagtttgtacaaagagttaacgtggttggagtacaag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6313257 |
tggaggaccacccttgagtgaaaagatagtgcctttaccttctttaatgttaaaaaaagaagaaagtttgtacaaagagttcacgtggttggagtacaag |
6313158 |
T |
 |
| Q |
107 |
aaagaaatgtacaattcaaggctggctgataatagacttgggccttttgaaaaatcttatggcaaatgaagaaaatacctcacaattaattctgaatgtt |
206 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
6313157 |
aaagcaatgtacaattcaaggctggctgattatagacttgggccttttgaaaaatcttatggcaaatgaagcaaatacctcaaaattaattctgaatgtt |
6313058 |
T |
 |
| Q |
207 |
ggcacatgatatttggccttt |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6313057 |
ggcacatgatatttggccttt |
6313037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University